Molecular Basis of Inheritance - Class 12 Biology

Class 12 Biology | Unit VI — Genetics & Evolution

Chapter 6: Molecular Basis of Inheritance

DNA Structure • Replication • Transcription • Translation • Regulation

1. DNA — The Genetic Material

1.1 Griffith's Experiment (1928) — Transforming Principle

📋 Discovery & History: Frederick Griffith (1928) worked with Streptococcus pneumoniae (Pneumococcus). Two strains: S-strain (Smooth, virulent — polysaccharide coat) and R-strain (Rough, non-virulent — no coat).

Experiment & Observations:

Live R-strain injected into mice → Mice survive.
Live S-strain injected into mice → Mice die (pneumonia).
Heat-killed S-strain injected → Mice survive.
Heat-killed S-strain + Live R-strain injected → Mice die. Live S-strain recovered from dead mice.

Conclusion: Some “transforming principle” passed from heat-killed S-strain to R-strain, converting R into virulent S-type. Griffith did NOT identify what this principle was.

⚠️ NEET Focus: Griffith discovered transformation but did NOT identify the transforming principle as DNA. That was done by Avery, MacLeod & McCarty (1944).

1.2 Avery, MacLeod & McCarty (1944) — DNA is the Transforming Principle

Treated the transforming principle with:

Proteases (destroys proteins) → Transformation still occurs.
RNase (destroys RNA) → Transformation still occurs.
DNase (destroys DNA) → Transformation does NOT occur.

Conclusion: DNA is the genetic material (transforming principle).

1.3 Hershey & Chase Experiment (1952) — Confirmatory Proof

📋 Experiment: Used bacteriophage T2 infecting E. coli. Phage has DNA core + protein coat. Two batches grown:
• Batch 1: Radioactive ³⁵S (sulphur — labels proteins, since protein has S but DNA doesn't).
• Batch 2: Radioactive ³²P (phosphorus — labels DNA, since DNA has P but protein doesn't).

After infecting E. coli and centrifuging:

³⁵S found in supernatant (outside cells = in protein coats). New phages had no ³⁵S.
³²P found in pellet (inside cells). New phages had ³²P.

Conclusion: DNA (not protein) is injected into host and acts as genetic material.

⚠️ NEET Focus (2014, 2016, 2018): ³²P labels DNA. ³⁵S labels protein. DNA enters bacteria; protein remains outside. Radioactive DNA is found in progeny phage.

1.4 Structure of DNA — Watson & Crick Double Helix Model (1953)

📋 Discovery & Nobel Prize: James Watson and Francis Crick proposed the double helix model of DNA in 1953, based on X-ray crystallography data by Rosalind Franklin & Maurice Wilkins. Nobel Prize 1962 (Watson, Crick, Wilkins).

Key Features of DNA Double Helix:

Two polynucleotide chains coiled right-handed in an antiparallel orientation (5′→3′ and 3′→5′).
Sugar (deoxyribose) and phosphate form the backbone on the outside.
Nitrogenous bases face inward and pair by hydrogen bonds:
- Adenine (A) — Thymine (T): 2 hydrogen bonds (A=T).
- Guanine (G) — Cytosine (C): 3 hydrogen bonds (G≡C).
Pitch (one complete turn) = 3.4 nm | Base pairs per turn = 10 bp | Distance between two base pairs = 0.34 nm.
Diameter of double helix = 2 nm.

Type	Bases	H-bonds	Rule
Purines	Adenine (A), Guanine (G)	—	Double-ringed
Pyrimidines	Thymine (T), Cytosine (C), Uracil (U)	—	Single-ringed
A = T	Adenine — Thymine	2	Chargaff's Rule
G ≡ C	Guanine — Cytosine	3	Chargaff's Rule

⚠️ NEET Focus (2013, 2017, 2019, 2021): Chargaff's Rule: A = T and G = C → Purine total = Pyrimidine total. 3.4 nm = pitch. 0.34 nm = rise per base pair. 10 bp per turn. G≡C bonds are stronger (3 H-bonds) than A=T (2 H-bonds).

1.5 Nucleosome — DNA Packaging

Definition: A nucleosome is the basic repeating unit of chromatin. DNA wraps around an octamer of histone proteins (H2A, H2B, H3, H4 — two copies each) — forming a “beads on a string” structure. Histone H1 is the linker histone.

DNA is negatively charged (due to phosphate groups). Histones are positively charged (rich in Lysine and Arginine) — enabling strong association. Length of DNA in one nucleosome = 200 bp (146 bp around core + ~54 bp linker).

Levels of Packaging:

DNA double helix (2 nm)
Nucleosome fibre “beads on string” (11 nm)
30 nm solenoid fibre (histones + linker)
300 nm chromatin loop
700 nm condensed metaphase chromosome

⚠️ NEET Focus (2015, 2020): Histones are rich in Lysine (K) and Arginine (R) — basic amino acids, positively charged. Histone H1 is NOT part of the core octamer — it is the linker histone. One nucleosome core has 8 histones (2 each of H2A, H2B, H3, H4).

2. DNA Replication

Definition: DNA replication is the process of producing two identical copies of DNA from one original molecule. It is semiconservative — each daughter DNA has one parental strand and one newly synthesised strand.

2.1 Meselson & Stahl Experiment (1958) — Proof of Semiconservative Replication

📋 Experiment: Grew E. coli in heavy nitrogen (¹⁵N) medium for many generations → all DNA is heavy (¹⁵N-¹⁵N). Then transferred to light nitrogen (¹⁴N) medium. After:
• 1 generation: All DNA = hybrid (¹⁵N-¹⁴N) — intermediate density.
• 2 generations: 50% hybrid + 50% light (¹⁴N-¹⁴N).
Density-gradient centrifugation (CsCl) used to separate bands.

Conclusion: Results matched semiconservative model, ruling out conservative and dispersive models.

⚠️ NEET Focus (2016, 2019, 2022): Technique used = CsCl density gradient centrifugation. After 1st generation = only hybrid DNA. After 2nd generation = 1 hybrid : 1 light. Taylor et al. confirmed semiconservative replication in Vicia faba (broad bean).

2.2 Replication Machinery

Key Enzymes and their functions:

Enzyme / Molecule	Function
Helicase	Unwinds and separates the two DNA strands at the replication fork
Primase	Synthesises a short RNA primer (needed to start synthesis)
DNA Polymerase III	Main enzyme; synthesises DNA in 5′→3′ direction only
DNA Polymerase I	Removes RNA primer; fills in gap with DNA
DNA Ligase	Joins Okazaki fragments on the lagging strand; seals nicks
SSB proteins	Stabilise single-stranded DNA at replication fork
Topoisomerase	Relieves torsional stress (supercoiling) ahead of replication fork

Leading vs Lagging Strand:

Leading strand: Synthesised continuously in the 5′→3′ direction (same direction as fork movement).
Lagging strand: Synthesised discontinuously as Okazaki fragments (short ~1000–2000 bp in prokaryotes; ~100–200 bp in eukaryotes) in 5′→3′ direction (opposite to fork movement).

⚠️ NEET Focus (2015, 2018, 2020): DNA polymerase synthesises only in 5′→3′ direction. Lagging strand needs Okazaki fragments joined by DNA Ligase. Origin of replication in E. coli = oriC. Human DNA has ~50,000 origins. E. coli replication time ~38 min for 4.6 × 10⁶ bp.

3. Transcription — DNA → RNA

Definition: Transcription is the process of synthesising RNA from a DNA template using RNA polymerase. The DNA strand that serves as template is the template/antisense strand; the other strand is the coding/sense strand.

3.1 Transcription Unit

A transcription unit consists of 3 components:

Promoter: Upstream (3′ end of template strand), controls start of transcription. RNA polymerase binds here.
Structural gene: The region that is transcribed into RNA.
Terminator: Downstream (5′ end of template strand), where transcription terminates.

3.2 Prokaryotic Transcription (E. coli)

📋 RNA Polymerase: Single RNA polymerase in prokaryotes that transcribes ALL types of RNA (mRNA, tRNA, rRNA). Consists of core enzyme (α₂ββ′ω) + sigma factor (σ).
• Sigma factor (σ) recognises the promoter sequence.
• Rho factor (ρ) involved in Rho-dependent termination.

Steps: Initiation → Elongation → Termination.

In prokaryotes, transcription and translation are coupled (happen simultaneously in cytoplasm — no nuclear membrane).

3.3 Eukaryotic Transcription

Three types of RNA polymerase in eukaryotes:

RNA Polymerase	Location	Transcribes
RNA Pol I	Nucleolus	rRNA (28S, 18S, 5.8S) — most rRNA
RNA Pol II	Nucleoplasm	hnRNA (precursor of mRNA) — most important
RNA Pol III	Nucleoplasm	tRNA, snRNA, 5S rRNA

3.4 Post-Transcriptional Processing (Eukaryotes only)

Pre-mRNA (hnRNA) undergoes:

5′ Capping: Addition of 7-methyl guanosine (m⁷G) cap at the 5′ end — protects from degradation, helps in translation initiation.
3′ Polyadenylation: Addition of poly-A tail (200–250 adenine residues) at 3′ end — increases mRNA stability.
Splicing: Removal of non-coding intervening sequences (introns) and joining of coding sequences (exons) by spliceosomes.

Resultant mature mRNA is transported to cytoplasm for translation.

⚠️ NEET Focus (2013, 2016, 2019, 2021): Introns = intervening sequences (non-coding, removed). Exons = expressed sequences (coding, retained). In prokaryotes, NO introns. 5′ cap = 7-methyl guanosine (NOT adenine). Poly-A tail at 3′ end. Template strand = antisense strand = used for transcription.

4. Genetic Code

Definition: The genetic code is the relationship between the sequence of nucleotide triplets (codons) in mRNA and the amino acids they specify during protein synthesis.

📋 Discovery & History:
• George Gamow (1954) proposed the triplet codon concept.
• Francis Crick and colleagues experimentally confirmed triplet nature.
• Har Gobind Khorana (Nobel 1968): synthesised artificial mRNAs, cracked the code.
• Marshall Nirenberg (Nobel 1968): first decoded codon — UUU = Phenylalanine.
• Robert Holley (Nobel 1968): sequenced first tRNA (alanine tRNA).

Properties of Genetic Code:

Triplet: Each codon = 3 nucleotides → total 4³ = 64 codons.
Degenerate: More than one codon for most amino acids (except Met and Trp). 61 codons code for 20 amino acids.
Non-overlapping: Each nucleotide belongs to only one codon.
Commaless: No punctuation between codons.
Universal: Same genetic code in nearly all organisms (minor exceptions in mitochondria).
Unambiguous: One codon codes for only one amino acid.

Codon	Meaning	Details
AUG	Start codon (Initiator)	Codes for Methionine (Met). Also called P-site initiator.
UAA	Stop codon (Ochre)	Termination — no amino acid. Most common stop codon.
UAG	Stop codon (Amber)	Termination — no amino acid.
UGA	Stop codon (Opal/Umber)	Termination — no amino acid.
UUU / UUC	Phenylalanine (Phe)	First codon decoded (Nirenberg, 1961).

⚠️ NEET Focus (2014, 2017, 2020, 2022): 64 total codons = 61 sense + 3 stop codons (UAA, UAG, UGA). Only AUG is the start codon. Methionine and Tryptophan — the only amino acids with single codon. Genetic code is universal but has exceptions (mitochondrial code).

4.1 Wobble Hypothesis (Crick, 1966)

The 3rd base of anticodon (wobble position) can form non-Watson-Crick base pairs, allowing one tRNA to recognise multiple codons. This explains degeneracy of genetic code.

5. Translation (Protein Synthesis)

Definition: Translation is the process of synthesising a polypeptide chain from the information encoded in mRNA, using ribosomes, tRNAs, and various protein factors.

5.1 tRNA — Adapter Molecule

tRNA was proposed as adapter molecule by Francis Crick. Each tRNA:

Has an anticodon loop that reads the mRNA codon by complementary base pairing.
Has a 3′-CCA-OH end (acceptor stem) where amino acid attaches.
Has cloverleaf secondary structure and L-shaped 3D structure.

5.2 Ribosomes

Feature	Prokaryotic (70S)	Eukaryotic (80S)
Large subunit	50S (23S rRNA + 5S rRNA + 34 proteins)	60S (28S, 5.8S, 5S rRNA + 49 proteins)
Small subunit	30S (16S rRNA + 21 proteins)	40S (18S rRNA + 33 proteins)
Inhibited by	Streptomycin, Erythromycin, Chloramphenicol	Cycloheximide

5.3 Steps of Translation

Activation (Charging): Amino acid + tRNA + ATP → aminoacyl-tRNA. Enzyme: aminoacyl-tRNA synthetase (20 types — one per amino acid). Called the “second genetic code”.
Initiation:
- Small ribosomal subunit binds mRNA at AUG start codon.
- Initiator tRNA (Met-tRNA^f) binds AUG at P-site.
- Large subunit joins → complete initiation complex.
- Requires initiation factors (IF1, IF2, IF3 in prokaryotes; eIF in eukaryotes) + GTP.
Elongation:
- New aminoacyl-tRNA enters A-site.
- Peptide bond forms between amino acids via peptidyl transferase (activity of 23S/28S rRNA — a ribozyme).
- Translocation: Ribosome moves 3 nt in 3′ direction. tRNA moves from A → P → E site.
- Requires EF-Tu, EF-G elongation factors + GTP.
Termination:
- Stop codon (UAA, UAG, UGA) reaches A-site.
- Release factors (RF) bind → peptidyl transferase adds water → polypeptide released.
- Ribosome dissociates into subunits.

⚠️ NEET Focus (2013, 2016, 2019, 2022): Peptide bond formed by peptidyl transferase = ribosomal RNA (ribozyme), NOT ribosomal protein. Amino acid enters at A-site; P-site has growing peptide; E-site is exit site. Polysomes = multiple ribosomes on one mRNA (increases efficiency).

6. Regulation of Gene Expression — lac Operon

Definition: An operon is a cluster of functionally related genes under the control of a single promoter, transcribed as a single mRNA. lac operon = model for negative regulation in prokaryotes.

📋 Discovery: Proposed by Francois Jacob and Jacques Monod (1961, Nobel Prize 1965). Studied in Escherichia coli.

Components of lac Operon:

i gene (Regulator gene): Produces lac repressor protein (constitutively expressed).
p (Promoter): RNA polymerase binding site.
o (Operator): Repressor binding site. Overlaps with promoter.
z gene: Encodes β-galactosidase (cleaves lactose → glucose + galactose).
y gene: Encodes permease (transports lactose into cell).
a gene: Encodes transacetylase (minor role).

Regulation:

Condition	Repressor State	Operator	Transcription
No lactose (default)	Active repressor	Blocked	OFF
Lactose present	Allolactose binds repressor → inactive	Open	ON
Glucose absent + Lactose present	Inactive repressor + CAP-cAMP active	Open + CAP enhances	ON (high)
Glucose present	cAMP low → CAP inactive	Even if open	ON (low)

Inducer = Allolactose (metabolite of lactose). Catabolite repressor = CAP + cAMP — positive regulation.

⚠️ NEET Focus (2014, 2017, 2019, 2021): lac operon = inducible, negative regulation. Inducer = allolactose (isomer of lactose). CAP + cAMP = positive regulator (activated when glucose absent). Jacob and Monod — Nobel 1965. Constitutive enzyme = always expressed (i gene).

7. Human Genome Project (HGP)

Definition: HGP was an international scientific research project (1990–2003) to sequence the entire human genome and identify all genes. Completed in 2003.

Key Findings of HGP:

Human genome has approximately 3 × 10⁹ bp (3 billion base pairs).
Number of genes: approximately 20,000–25,000 (much fewer than expected).
Average gene size: 3,000 bp (largest known: Dystrophin gene — 2.4 million bp).
Chromosome 1 has maximum genes; Chromosome Y has fewest.
~99.9% of nucleotide base sequences are the same in all humans.
Less than 2% of human genome codes for proteins.
Repetitive sequences = ~50% of genome (no known function — sometimes called “junk DNA”).

Technologies used: Expressed Sequence Tags (ESTs) and Sequence Annotation. Automated DNA sequencers based on Frederick Sanger's chain termination method (dideoxy method).

⚠️ NEET Focus (2015, 2018, 2020): Human genome = 3 × 10⁹ bp. Genes = 20,000–25,000. Protein-coding = less than 2%. Largest gene = Dystrophin. HGP completed: 2003. Started: 1990.

7.1 DNA Fingerprinting (DNA Profiling)

Definition: DNA fingerprinting is a technique to identify an individual based on unique repetitive sequences in their DNA called VNTRs (Variable Number of Tandem Repeats). Developed by Alec Jeffreys (1984).

Basis: Every individual (except identical twins) has a unique pattern of VNTRs. The number of repeating units varies — creating a unique “fingerprint” for each person.

Steps: Extract DNA → Restriction digestion → Gel electrophoresis → Southern blotting → Hybridisation with radioactive VNTR probe → Autoradiography → Pattern visualised.

Applications: Forensic identification, Paternity/maternity disputes, Immigration cases, Identification of disaster victims.

⚠️ NEET Focus (2016, 2019): VNTRs are in the satellite DNA region. Southern blotting: DNA → membrane (nitrocellulose/nylon). Northern blotting: RNA → membrane. Western blotting: Protein → membrane. DNA fingerprinting by Alec Jeffreys (1984).

🎓 Key NEET Questions (Previous Years)

Q1. [NEET 2022] In E. coli, which RNA polymerase subunit is responsible for recognition of the promoter?

(a) Alpha (α) subunit (b) Beta (β) subunit (c) Sigma (σ) factor (d) Omega (ω) subunit

Answer: (c) The sigma (σ) factor is responsible for promoter recognition. It dissociates after initiation; the core enzyme (α₂ββ′ω) then carries out elongation.

Q2. [NEET 2021] Which one of the following has highest AT:GC ratio?

(a) Bacteriophage ΦX174 (b) E. coli (c) Human (d) Mycobacterium tuberculosis

Answer: (a) Bacteriophage ΦX174 has the highest AT content. M. tuberculosis has high GC content (64.9%). High AT ratio = more 2H-bond pairs = lower melting temperature.

Q3. [NEET 2019] The removal of introns and joining of exons in a defined order during RNA processing is called:

(a) Transformation (b) Translation (c) Transcription (d) Splicing

Answer: (d) Splicing is the process of removing introns and joining exons by the spliceosome complex to produce mature mRNA.

Q4. [NEET 2017] Number of chromosomes in human haploid genome and approximate number of genes:

(a) 23, 20,000–25,000 (b) 46, 30,000 (c) 23, 1,00,000 (d) 46, 20,000–25,000

Answer: (a) Haploid genome = 23 chromosomes, approximately 20,000–25,000 genes. Total DNA = 3 × 10⁹ bp.

Q5. [NEET 2016] In Meselson and Stahl experiment, after two generations the DNA ratio was:

(a) 1 Hybrid : 1 Heavy (b) 1 Light : 1 Hybrid (c) All Hybrid (d) 1 Heavy : 2 Hybrid : 1 Light

Answer: (b) After 2 generations = 50% light (¹⁴N-¹⁴N) : 50% hybrid (¹⁵N-¹⁴N). After 1 generation = all hybrid (100%).

Q6. [NEET 2014] Which of the following is NOT a property of genetic code?

(a) It is universal (b) It is degenerate (c) It is ambiguous (d) It is non-overlapping

Answer: (c) Genetic code is unambiguous (one codon → only one amino acid), NOT ambiguous. It is universal, degenerate, and non-overlapping.

💡 Rapid Revision — Key Numbers

DNA double helix: pitch = 3.4 nm | 0.34 nm/bp | 10 bp/turn | diameter = 2 nm
A=T: 2 H-bonds | G≡C: 3 H-bonds | (Chargaff's Rule: A=T, G=C)
Nucleosome: 8 histones (2×H2A, H2B, H3, H4) + H1 linker | 200 bp DNA
Genetic code: 64 codons | 61 sense | 3 stop (UAA, UAG, UGA)
Start codon: AUG (Methionine) | Single-codon AAs: Met & Trp
Prokaryotic ribosome: 70S (50S + 30S) | Eukaryotic: 80S (60S + 40S)
Human genome: 3 × 10⁹ bp | Genes: 20,000–25,000 | Protein coding: <2%
HGP: 1990–2003 | Dystrophin = largest gene (2.4 × 10⁶ bp)
Watson & Crick: 1953 | Meselson & Stahl: 1958 | Jacob & Monod: Nobel 1965

NCERT Solutions - Molecular Basis of Inheritance - Class 12

CLASS 12 BIOLOGY | NCERT SOLUTIONS

Chapter 6 — Molecular Basis of Inheritance

All NCERT Exercise Questions with Detailed Solutions

📋 Note: All questions are from NCERT Class 12 Biology Chapter 6 Exercise. Answers as per NCERT and CBSE marking scheme.

NCERT Exercise Questions & Solutions

1 Mark Q1. Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil, Deoxyadenosine.

✓ Answer
Nitrogenous Bases: Adenine, Thymine, Uracil
Nucleosides (base + sugar, NO phosphate): Cytidine (Cytosine + Ribose), Guanosine (Guanine + Ribose), Deoxyadenosine (Adenine + Deoxyribose)

Note: Nucleoside = Base + Sugar. Nucleotide = Base + Sugar + Phosphate.

2 Marks Q2. If a double stranded DNA has 20% of cytosine, what will be the percentage of adenine in it?

✓ Answer
By Chargaff's Rule: In dsDNA, C = G and A = T.
Cytosine (C) = 20% → Guanine (G) = 20%
Total C + G = 40%
Remaining = A + T = 100% − 40% = 60%
Since A = T: A = 60% ÷ 2 = 30%

∴ Adenine = 30% (and Thymine = 30%)

2 Marks Q3. If the sequence of one strand of DNA is written 5′-ATGCATGCATGC-3′, what will be the sequence of complementary strand written in 5′→3′ direction?

✓ Answer
Given strand (5′→3′): 5′−A T G C A T G C A T G C−3′
Complementary (3′→5′): 3′−T A C G T A C G T A C G−5′

Written in 5′→3′ direction (reverse): 5′−GCATGCATGCAT−3′

Pairing: A pairs with T; G pairs with C. Complementary strand is antiparallel.

2 Marks Q4. If the sequence of the coding strand in a transcription unit is written as 5′-ATGCATGCATGCATGCATGCATGC-3′, what would be the sequence of mRNA?

✓ Answer
The coding strand (non-template strand) has the same sequence as the mRNA, EXCEPT T is replaced by U.

Coding strand: 5′−ATGCATGCATGCATGCATGCATGC−3′
mRNA sequence: 5′−AUGCAUGCAUGCAUGCAUGCAUGC−3′

Note: Template strand is the complementary strand (antisense strand). mRNA is synthesised complementary to the template strand.

3 Marks Q5. Which property of DNA double helix led Watson and Crick to hypothesize semi-conservative mode of DNA replication? Explain.

✓ Answer
The complementary base pairing property of DNA (A=T and G≡C) led Watson and Crick to propose semiconservative replication.

Reasoning: Since each strand has a specific base sequence complementary to the other, each parental strand can serve as a template for synthesis of a new complementary strand. This means:

The two parental strands unwind and separate.
Each strand acts as template for new synthesis (A pairs with T, G pairs with C).
Each daughter DNA molecule has one parental (old) strand + one newly synthesised strand.

This was confirmed experimentally by Meselson and Stahl (1958) using ¹⁵N and ¹⁴N isotopes with CsCl density gradient centrifugation.

3 Marks Q6. Briefly describe the contribution of the following scientists in deciphering the genetic code: (a) Marshall Nirenberg (b) Har Gobind Khorana (c) Francis Crick.

✓ Answer
(a) Marshall Nirenberg: In 1961, he synthesised artificial poly-U RNA (UUUUUU...) and used cell-free translation systems. He found that poly-U produced only Phenylalanine. This was the first codon decoded: UUU = Phenylalanine. He also decoded all 64 codons. Nobel Prize 1968.

(b) Har Gobind Khorana: Chemically synthesised specific RNA polymers with known sequences and used them to identify codons. He confirmed the triplet nature of the genetic code and helped establish the complete codon table. Nobel Prize 1968.

(c) Francis Crick: Proposed that the genetic code is a triplet code (codon) that is non-overlapping and commaless. He also predicted and confirmed the existence of adapter molecules (tRNA). He proposed the Wobble Hypothesis to explain degeneracy.

3 Marks Q7. Briefly describe the process of transcription in bacteria.

✓ Answer
In bacteria, single RNA polymerase (core enzyme α₂ββ′ω + sigma factor σ) transcribes all types of RNA (mRNA, tRNA, rRNA).

Initiation: Sigma factor (σ) recognises and binds to the promoter sequence (−10 region: TATAAT; −35 region: TTGACA). RNA polymerase unwinds ~17 bp of DNA forming the transcription bubble. RNA synthesis begins at the +1 site in the 5′→3′ direction.
Elongation: Sigma factor dissociates; core enzyme moves along template strand (3′→5′) synthesising RNA using ribonucleoside triphosphates. Complementary RNA is built 5′→3′. No proofreading in transcription.
Termination:
- Rho-independent: RNA forms a stem-loop hairpin followed by poly-U → RNA polymerase falls off.
- Rho-dependent: Rho (ρ) factor catches up with RNA polymerase → releases RNA.

In prokaryotes, transcription and translation are coupled (simultaneous in cytoplasm). No post-transcriptional processing required.

3 Marks Q8. Describe briefly the process of replication in E. coli.

✓ Answer
E. coli DNA replication is semiconservative, bidirectional and starts from a single origin oriC.

Initiation: DnaA proteins bind oriC → Helicase (DnaB) unwinds dsDNA → SSB proteins stabilise ssDNA → Primase synthesises short RNA primers.
Elongation:
- Leading strand: DNA Pol III synthesises continuously in 5′→3′ direction toward replication fork.
- Lagging strand: Synthesised discontinuously as Okazaki fragments (1,000–2,000 bp). Each fragment requires a new primer.
- Once elongation is complete, DNA Pol I removes RNA primers and fills in gaps with DNA.
- DNA Ligase seals nicks and joins Okazaki fragments.
Termination: Two replication forks meet at the terminus (ter) region. Topoisomerase II (gyrase) resolves interlinked chromosomes (decatenation).

Total time to replicate E. coli genome (4.6 × 10⁶ bp): ~38 minutes.

5 Marks Q9. Explain the lac operon in detail.

✓ Answer
lac Operon (Jacob & Monod, 1961) — a model for gene regulation in prokaryotes. Present in E. coli.

Structure:

i gene: Regulator gene; produces lac repressor (constitutively active).
p: Promoter — RNA polymerase binding site.
o: Operator — repressor binding region (overlaps with promoter).
z gene: β-galactosidase (cleaves lactose → glucose + galactose).
y gene: Permease (transports lactose into cell).
a gene: Transacetylase (minor role).

Regulation:

Condition	Repressor	Transcription
No lactose	Active (binds operator)	OFF
Lactose present	Allolactose inactivates repressor	ON
No glucose + Lactose	Inactive + CAP-cAMP activates	ON (maximal)

The lac operon is an example of negative regulation (repressor turns gene OFF) and inducible system (inducer turns gene ON). CAP (catabolite activator protein) + cAMP provides positive regulation when glucose is absent.

3 Marks Q10. Explain (in not more than 100 words) how the Human Genome Project could revolutionise medicine.

✓ Answer
The Human Genome Project (HGP) revolutionises medicine by:

Disease prediction: Identifying genetic mutations associated with diseases (cancer, diabetes, Alzheimer's) allows early diagnosis and preventive interventions.
Personalised medicine: Drugs tailored to an individual's genetic profile (pharmacogenomics) — improved efficacy, reduced side effects.
Gene therapy: Correcting defective genes in inherited disorders (e.g., ADA-SCID, cystic fibrosis).
Drug development: Gene products (proteins) can be used to develop new drugs and vaccines.
Understanding evolution: Comparative genomics helps understand evolutionary relationships between organisms.

3 Marks Q11. Briefly describe the salient features of the genetic code.

✓ Answer

Triplet: Each codon consists of 3 nucleotides. 4³ = 64 possible codons.
Degenerate: Multiple codons specify the same amino acid (except Met and Trp). 61 codons for 20 amino acids.
Non-overlapping: Each nucleotide belongs to only one codon.
Commaless: No punctuation between codons; read continuously.
Universal: Same genetic code in virtually all organisms — from bacteria to humans. Minor exceptions in mitochondria.
Unambiguous: Each codon specifies only ONE amino acid (some amino acids have multiple codons, but one codon = one amino acid).
AUG: START codon (methionine). UAA, UAG, UGA: STOP codons (non-sense codons).

Facts Capsule - Molecular Basis of Inheritance - Class 12

CLASS 12 BIOLOGY | NEET RAPID CAPSULE

Facts & High-Yield Points

Chapter 6 — Molecular Basis of Inheritance | 30 Key Facts for NEET

🧬 DNA Structure

FACT #01 — Watson & Crick

Double helix model proposed in 1953. Based on X-ray data from Rosalind Franklin & Wilkins. Nobel Prize 1962 (Watson, Crick, Wilkins — NOT Franklin).

FACT #02 — Helix Dimensions

Pitch = 3.4 nm | Rise per bp = 0.34 nm | Base pairs/turn = 10 | Diameter = 2 nm. Right-handed helix. Antiparallel strands.

FACT #03 — Chargaff's Rule

A = T (2 H-bonds) | G = C (3 H-bonds). Purines = Pyrimidines. Higher G+C content = higher melting temperature (more H-bonds).

FACT #04 — Purines vs Pyrimidines

Purines (double ring): Adenine, Guanine — “AG”.
Pyrimidines (single ring): Cytosine, Thymine, Uracil — “CUT”. Uracil only in RNA.

FACT #05 — Nucleosome

Core = 8 histones (2×H2A, H2B, H3, H4). H1 = linker histone. DNA wraps: 146 bp around core (+54 bp linker = 200 bp total). Histones rich in Lys + Arg (positive charge).

FACT #06 — Griffith + Avery

Griffith (1928): Discovery of transformation (transforming principle, no ID). Avery et al. (1944): Proved DNA is the transforming principle (DNase → no transformation).

FACT #07 — Hershey & Chase (1952)

³²P labels DNA (found in pellet/bacteria). ³⁵S labels protein (found in supernatant). Proved DNA is injected into bacteria, NOT protein.

🔄 DNA Replication

FACT #08 — Meselson & Stahl (1958)

Proved semiconservative replication. Used ¹⁵N → ¹⁴N transfer. After 1 gen = all hybrid. After 2 gen = 50% hybrid + 50% light. Technique: CsCl density gradient.

FACT #09 — DNA Polymerase Direction

DNA polymerase synthesises only in 5′→3′ direction. Reads template in 3′→5′. Requires RNA primer. Cannot start de novo.

FACT #10 — Leading vs Lagging

Leading strand: continuous synthesis. Lagging strand: Okazaki fragments (1,000–2,000 bp prokaryotes; 100–200 bp eukaryotes). Joined by DNA Ligase.

FACT #11 — Replication Enzymes

📝 Transcription

FACT #12 — RNA Polymerases (Eukaryote)

RNA Pol I: rRNA (28S, 18S, 5.8S) — nucleolus.
RNA Pol II: mRNA (hnRNA) — most important.
RNA Pol III: tRNA, snRNA, 5S rRNA.

FACT #13 — Prokaryotic RNA Pol

Single RNA polymerase; core enzyme = α₂ββ′ω. Sigma (σ) factor = promoter recognition. Dissociates after initiation. Rho (ρ) factor = Rho-dependent termination.

FACT #14 — Template vs Coding Strand

Template strand = antisense strand = used for transcription (3′→5′). Coding strand = sense strand = same sequence as mRNA (T replaced by U). Not transcribed.

FACT #15 — Post-Transcriptional Processing

Eukaryotes only: (1) 5′ capping: 7-methyl guanosine (stability + translation initiation). (2) 3′ poly-A tail: 200–250 A residues (stability). (3) Splicing: introns removed, exons joined.

FACT #16 — Introns vs Exons

Introns = Intervening sequences = NON-coding = removed by spliceosomes. Exons = Expressed sequences = coding = retained in mature mRNA. Prokaryotes: NO introns.

📒 Genetic Code

FACT #17 — Code Properties (TUNDCU)

FACT #18 — Start & Stop Codons

AUG = Start (Met). UAA (Ochre), UAG (Amber), UGA (Opal/Umber) = Stop codons. Met & Trp = only amino acids with single codon.

FACT #19 — Code Breakers

Gamow (1954): triplet concept. Nirenberg (1961): UUU = Phe (first decoded). Khorana: synthesised artificial RNA. Crick: wobble hypothesis. Nobel 1968: Nirenberg, Khorana, Holley.

FACT #20 — tRNA Adapter

Proposed by Crick. Has anticodon loop (reads mRNA) + 3′-CCA-OH acceptor stem (attaches amino acid). Cloverleaf secondary; L-shaped 3D. Charged by aminoacyl-tRNA synthetase.

⚙️ Translation

FACT #21 — Ribosome Sizes

Prokaryotic: 70S = 50S + 30S. Eukaryotic: 80S = 60S + 40S. Mitochondria & Chloroplast: 70S (prokaryotic-type). Inhibited by: Streptomycin (30S), Chloramphenicol (50S), Cycloheximide (eukaryotic 80S).

FACT #22 — Peptide Bond & Ribozyme

Peptide bond formation = peptidyl transferase activity = catalysed by 23S rRNA (prokaryote) / 28S rRNA (eukaryote) — a ribozyme (RNA enzyme), NOT protein.

FACT #23 — Ribosome Sites

A-site (Aminoacyl): Entry of new aminoacyl-tRNA.
P-site (Peptidyl): Growing polypeptide chain.
E-site (Exit): Discharged tRNA exits.

FACT #24 — Second Genetic Code

Aminoacyl-tRNA synthetases (20 types, one per amino acid) — correctly attach each amino acid to its cognate tRNA. Called the “second genetic code” because specificity is established here.

🏧 lac Operon & HGP

FACT #25 — lac Operon

Proposed by Jacob & Monod, Nobel 1965. Inducible operon. Inducer = allolactose (isomer of lactose). Negative regulation (repressor). CAP + cAMP = positive regulation.

FACT #26 — lac Genes

z: β-galactosidase (lactose → glucose + galactose). y: permease (lactose transport). a: transacetylase. i: repressor gene (constitutive). Order: i–p–o–z–y–a.

FACT #27 — Human Genome Project

Duration: 1990–2003. Genome size: 3 × 10⁹ bp. Genes: 20,000–25,000. Protein coding: <2%. Repetitive DNA: ~50%. 99.9% sequences identical in all humans.

FACT #28 — HGP Notable Facts

Largest gene: Dystrophin (2.4 × 10⁶ bp). Most genes: Chromosome 1. Fewest: Chromosome Y. Average gene size: 3,000 bp. Sequencing: Sanger's dideoxy chain termination method.

FACT #29 — DNA Fingerprinting

Developed by Alec Jeffreys (1984). Based on VNTRs (Variable Number of Tandem Repeats) in satellite DNA. Steps: Southern blotting → VNTR probe hybridisation → autoradiography.

FACT #30 — Blotting Types

Southern: DNA → membrane. Northern: RNA → membrane. Western: Protein → membrane. (S-N-W: DNA-RNA-Protein). Developer: Southern = Edwin Southern.

🧠 Mnemonics — Remember Fast

Purines: “PuRe AG” Purines = Adenine + Guanine (double ring). Pyrimidines = CUT (Cytosine, Uracil, Thymine).

Stop Codons: “UAA UAG UGA = U Are Awful” UAA (Ochre), UAG (Amber), UGA (Opal). All start with U.

RNA Pol: “1 Ribs, 2 Messengers, 3 Tiny” RNA Pol I = rRNA | Pol II = mRNA | Pol III = tRNA/snRNA (small).

Blotting: “SNoW DRoP” Southern = DNA | Northern = RNA | Western = Protein. (DNA, RNA, Protein = DRoP).

📊 Key Comparisons

Feature	Prokaryotes	Eukaryotes
RNA Polymerase	Single (α₂ββ′ω + σ)	Three types (I, II, III)
Introns	Absent	Present (spliced out)
mRNA Processing	None	5′ cap, poly-A, splicing
Transcription site	Cytoplasm	Nucleus
Translation	Coupled with transcription	Separate (cytoplasm)
Ribosome	70S	80S (cytoplasmic)
Okazaki fragments	1,000–2,000 bp	100–200 bp

🔢 Critical Numbers — Never Forget

3.4 nm — DNA helix pitch 0.34 nm — rise per base pair 10 bp — per turn of helix 2 nm — helix diameter 2 H-bonds — A=T 3 H-bonds — G≡C 64 — total codons 61 — sense codons 3 — stop codons 8 histones — per nucleosome core 200 bp — DNA per nucleosome 3 × 10⁹ bp — human genome 20,000–25,000 — human genes <2% — protein-coding DNA 1953 — Watson & Crick model 1990–2003 — HGP

📱 Practice MCQs for this topic inside our App